MultiPro® 5CFLX Anti-Human CD163 (GHI/61)

• 

  Single Cell Sequencing experiment G65169-1-5C on Resting PBMC

  G65169-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65169-1-5C on PBMC treated with 4hr LPS + TI

  G65169-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD163 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65169-1-5C

Clone No.GHI/61

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD163, CD163 molecule, Hemoglobin scavenger receptor, M130, MM130, sCD163

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65169-1-5C targets CD163 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Glycoprotein preparation from hairy cell leukemia spleen
• Full Name: MultiPro® 5CFLX Anti-Human CD163 (GHI/61)
• Calculated Molecular Weight: 1156 aa, 125 kDa
• GenBank Accession Number: BC051281
• Gene Symbol: CD163
• Gene ID (NCBI): 9332
• ENSEMBL Gene ID: ENSG00000177575
• RRID: AB_3673925
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGACCGCGACCTGATAACCCATATAAGAAA
• Barcode Sequence: ACCGCGACCTGATAA
• Form: Liquid
• UNIPROT ID: Q86VB7
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD163, also known as M130, is a membrane glycoprotein which belongs to the scavenger receptor superfamily (PMID: 8370408). It is an acute phase-regulated and signal-inducing macrophage protein expressed exclusively in monocytes and tissue macrophages (PMID: 11196644). CD163 mediates endocytosis of haptoglobin-haemoglobin complexes (PMID: 11196644). The uptake of haptoglobin by macrophages contributes to the recycling of iron and also to the inflammatory response (PMID: 22900885). Soluble CD163 (sCD163), as a result of ectodomain shedding during inflammatory activation of macrophages, circulates in blood and has been suggested as a plasma/serum marker for macrophage activity (PMID: 12570164).