MultiPro® 5CFLX Anti-Human CD122/IL-2RB (Polyclonal)

• 

  Single Cell Sequencing experiment G13602-1-5C on Resting PBMC

  G13602-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G13602-1-5C on PBMC treated with 4hr LPS + TI

  G13602-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD122/IL-2RB Polyclonal Antibody for Single Cell (Intra)

Cat No. G13602-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD122, CD122/IL-2RB, IL 2 receptor subunit beta, IL 2R subunit beta, IL 2RB, IL2RB, IL-2RB, interleukin 2 receptor, beta, P70 75, p75

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G13602-1-5C targets CD122/IL-2RB in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: CD122/IL-2RB fusion protein Ag3929
• Full Name: MultiPro® 5CFLX Anti-Human CD122/IL-2RB (Polyclonal)
• Calculated Molecular Weight: 551 aa, 61 kDa
• GenBank Accession Number: BC025691
• Gene Symbol: IL2RB
• Gene ID (NCBI): 3560
• ENSEMBL Gene ID: ENSG00000100385
• RRID: AB_3673884
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTCTGTGACAGCGACCCATATAAGAAA
• Barcode Sequence: GGTCTGTGACAGCGA
• Form: Liquid
• UNIPROT ID: P14784
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. The beta subunit (IL2RB, also known as CD122 and p75) is involved in receptor mediated endocytosis and transduces the mitogenic signals of nterleukin 2.