MultiPro® 5CFLX Anti-Human ATP1A1 (Polyclonal)

• 

  Single Cell Sequencing experiment G14418-1-5C on Resting PBMC

  G14418-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G14418-1-5C on PBMC treated with 4hr LPS + TI

  G14418-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

ATP1A1 Polyclonal Antibody for Single Cell (Intra)

Cat No. G14418-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

ATP1A1, Na(+)/K(+) ATPase 1, Na(+)/K(+) ATPase alpha 1 subunit, Na+/K+ ATPase 1, Sodium potassium ATPase alpha 1 polypeptide, Sodium pump subunit alpha 1

Formulation:  PBS and Azide

PBS and Azide

Conjugate:  {{ptg:cur_Conjugation}}

Unconjugated CoraLite® Plus 488

Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

- +

Request bulk or custom quote

Add to Basket

Please visit your regions distributor:

---

Proteintech Guarantee

---

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G14418-1-5C targets ATP1A1 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: ATP1A1 fusion protein Ag5763
• Full Name: MultiPro® 5CFLX Anti-Human ATP1A1 (Polyclonal)
• Calculated Molecular Weight: 113 kDa
• GenBank Accession Number: BC050359
• Gene Symbol: ATP1A1
• Gene ID (NCBI): 476
• ENSEMBL Gene ID: ENSG00000163399
• RRID: AB_3673887
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGAACATAATGATCCTCCCATATAAGAAA
• Barcode Sequence: GAACATAATGATCCT
• Form: Liquid
• UNIPROT ID: P05023
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

ATP1A1 is the catalytic component of Na+/K+-ATPase which is a membrane bound enzyme primarily involved in generation of Na+ and K+ gradients across plasma membranes and in determination of cytoplasmic Na+ levels. ATP1A1 is a ubiquitously expressed membrane protein and often used as the marker or internal control for plasma membrane protein. For optimal WB detection of this membrane protein, we recommend to avoid boiling the sample after lysis.